Review



paper n a smart primer  (OriGene)


Bioz Verified Symbol OriGene is a verified supplier
Bioz Manufacturer Symbol OriGene manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 97
      Buy from Supplier

    Structured Review

    OriGene paper n a smart primer
    Paper N A Smart Primer, supplied by OriGene, used in various techniques. Bioz Stars score: 97/100, based on 560 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/paper+n+a+smart+primer/Primer/pm30917329-240-39-70
    Average 97 stars, based on 560 article reviews
    paper n a smart primer - by Bioz Stars, 2026-10
    97/100 stars

    Images

    Related Articles

    Luciferase:

    Article Title: Transcriptomic Analysis of Single Isolated Myofibers Identifies miR-27a-3p and miR-142-3p as Regulators of Metabolism in Skeletal Muscle.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Tom20 Antibody (FL-145) Santa Cruz sc-11415; RRID: AB_2207533 Goat anti-Rabbit IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 568 Life Technologies A-11011; RRID: AB_143157 Myosin Heavy Chain Type IIA Antibody DSHB SC-71; RRID: AB_2147165 Anti-Dystrophin antibody Abcam ab15277 Alexa Fluor 488 AffiniPure Goat Anti-Mouse IgG, Fcg subclass 1 specific Jackson Immunoresearch 115545205; RRID: AB_2338854 Alexa Fluor 647 AffiniPure Goat Anti-Rabbit IgG (H+L) Jackson Immunoresearch 111605003; RRID: AB_2338072 Anti-GAA antibody produced in rabbit Sigma-Aldrich SAB2100872; RRID: AB_10604782 Anti-FNDC5 antibody [EPR12209] Abcam ab174833 Anti-FNDC5 antibody - C-terminal Abcam ab181884 Anti-PGM2 antibody [EPR10393(B)] Abcam ab151746 Rabbit IgG, HRP-linked whole Ab Amersham NA934; RRID: AB_772206 Bacterial and Virus Strains DH10b competent cells ThermoFisher 18290015 Biological Samples Soleus Muscles CD1 mice N/A EDL Muscles CD1 mice N/A C2C12 ATCC CRL-1772; RRID: CVCL_0188 Human primary myoblasts ABM T4068 Chemicals, Peptides, and Recombinant Proteins BODIPY 493/503 Life Technologies D3922 Critical Commercial Assays Complete Whole Transcriptome Amplification Kit Sigma-Aldrich WTA2 SureTag DNA Labeling Kit Agilent Technologies 5190-3400 Low Input Quick Amp Labeling Kit, one-color Agilent Technologies 5190-2305 SurePrint G3 Mouse GE 8x60K Microarray Kit Agilent Technologies G4852A Megaplex PreAmp Primers, Rodent Pool Set v3.0 Thermo Fischer Scientific 4444747 Megaplex RT Primers, Rodent Pool Set v3.0 Thermo Fischer Scientific 4444746 Seahorse XF Palmitate-BSA FAO Substrate Seahorse Bioscience 102720-100 Deposited Data Agilent SurePrint G3 Mouse GE 8x60K Microarray Platform dataset Agilent Technologies https://www.ncbi.nlm.nih.gov/geo/query/ acc.cgi?acc=GPL10787 miRBase, V.19 Griffiths-Jones, 2004 http://www.mirbase.org/ TargetScan, V.6.2 Friedman et al., 2009 www.targetscan.org/ mirSVR, August 2010 release Betel et al., 2010 http://www.microrna.org/microrna/home.do Raw microarray data This paper GEO: GSE98328 Raw miRNA-Seq fast myofibers This paper SRA: SRX2768351 Raw miRNA-Seq intermediate myofibers This paper SRA: SRX2768352 Raw miRNA-Seq slow myofibers This paper SRA: SRX2768353 Experimental Models: Cell Lines Mouse: C2C12 ATCC CRL-1772; RRID: CVCL_0188 Human: Primary Skeletal Muscle Myoblasts abm T4068 (Continued on next page) e1 Cell Reports 26, 3784–3797.e1–e8, March 26, 2019 .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental Models: Organisms/Strains Mouse: CD1 Charles River CD-1 IGS Mouse Mouse: C57BL/6J The Jackson Laboratory JAX: 000664 Oligonucleotides Primers for qRT-PCR: see Table S4 This paper N/A oligo-dT-Ion P1 Adaptor primer: CCTCTCTATGGGCAG TCGGTGATCCTCAGC[dT]20VN This paper N/A SMART primer: CACACACAATTAACCCTCACTAAAggg This paper N/A A Adaptor primer: CCATCTCATCCCTGCGTGTCTCC GACTCAG This paper N/A Primers luciferase assay: see Table S4 This paper N/A Recombinant DNA PCMVMIR MicroRNA Expression Vector Origene PCMVMIR PCMVMIR-27a Origene SC400942 PCMVMIR-142 Origene SC400778 Mito-RFP Evrogen FP147 pmirGLO Dual-Luciferase miRNA Target Expression Vector Promega E1330 Software and Algorithms Primer3Plus Untergasser et al., 2007 http://www.bioinformatics.nl/cgi-bin/ primer3plus/primer3plus.cgi Feature Extraction Software v. 10.7.3.1 Agilent Technologies G4463AA Expander Sharan et al., 2003 http://acgt.cs.tau.ac.il/expander/ Multiple Experiment Viewer Saeed et al., 2003 https://sourceforge.net/projects/mev-tm4/ SAM: Significance Analysis of Microarrays Tusher et al., 2001 http://statweb.stanford.edu/ tibs/SAM/ DAVID Bioinformatics Resources Huang et al., 2009 https://david.ncifcrf.gov/ PAM: Prediction Analysis for Microarrays Tibshirani et al., 2002 http://statweb.stanford.edu/ tibs/PAM/ miRDeep Friedländer et al., 2008 https://sourceforge.net/projects/mirdeepstar/ Cytoscape Shannon et al., 2003 https://cytoscape.org/ Prism Graphpad https://www.graphpad.com/scientific- software/prism/ ExpressionSuite Software Thermo Fischer Scientific https://www.thermofisher.com/us/en/home/ technical-resources/software-downloads/ expressionsuite-software.html ImageJ NIH https://imagej.nih.gov/ij/ MitoLoc Vowinckel et al., 2015 https://www.gurdon.cam.ac.uk/institute-life/ downloadspublic/imaging-plugins Other Rodent Diet With 60 kcal% Fat Research Diets D12492 ..

    Recombinant:

    Article Title: Transcriptomic Analysis of Single Isolated Myofibers Identifies miR-27a-3p and miR-142-3p as Regulators of Metabolism in Skeletal Muscle.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Tom20 Antibody (FL-145) Santa Cruz sc-11415; RRID: AB_2207533 Goat anti-Rabbit IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 568 Life Technologies A-11011; RRID: AB_143157 Myosin Heavy Chain Type IIA Antibody DSHB SC-71; RRID: AB_2147165 Anti-Dystrophin antibody Abcam ab15277 Alexa Fluor 488 AffiniPure Goat Anti-Mouse IgG, Fcg subclass 1 specific Jackson Immunoresearch 115545205; RRID: AB_2338854 Alexa Fluor 647 AffiniPure Goat Anti-Rabbit IgG (H+L) Jackson Immunoresearch 111605003; RRID: AB_2338072 Anti-GAA antibody produced in rabbit Sigma-Aldrich SAB2100872; RRID: AB_10604782 Anti-FNDC5 antibody [EPR12209] Abcam ab174833 Anti-FNDC5 antibody - C-terminal Abcam ab181884 Anti-PGM2 antibody [EPR10393(B)] Abcam ab151746 Rabbit IgG, HRP-linked whole Ab Amersham NA934; RRID: AB_772206 Bacterial and Virus Strains DH10b competent cells ThermoFisher 18290015 Biological Samples Soleus Muscles CD1 mice N/A EDL Muscles CD1 mice N/A C2C12 ATCC CRL-1772; RRID: CVCL_0188 Human primary myoblasts ABM T4068 Chemicals, Peptides, and Recombinant Proteins BODIPY 493/503 Life Technologies D3922 Critical Commercial Assays Complete Whole Transcriptome Amplification Kit Sigma-Aldrich WTA2 SureTag DNA Labeling Kit Agilent Technologies 5190-3400 Low Input Quick Amp Labeling Kit, one-color Agilent Technologies 5190-2305 SurePrint G3 Mouse GE 8x60K Microarray Kit Agilent Technologies G4852A Megaplex PreAmp Primers, Rodent Pool Set v3.0 Thermo Fischer Scientific 4444747 Megaplex RT Primers, Rodent Pool Set v3.0 Thermo Fischer Scientific 4444746 Seahorse XF Palmitate-BSA FAO Substrate Seahorse Bioscience 102720-100 Deposited Data Agilent SurePrint G3 Mouse GE 8x60K Microarray Platform dataset Agilent Technologies https://www.ncbi.nlm.nih.gov/geo/query/ acc.cgi?acc=GPL10787 miRBase, V.19 Griffiths-Jones, 2004 http://www.mirbase.org/ TargetScan, V.6.2 Friedman et al., 2009 www.targetscan.org/ mirSVR, August 2010 release Betel et al., 2010 http://www.microrna.org/microrna/home.do Raw microarray data This paper GEO: GSE98328 Raw miRNA-Seq fast myofibers This paper SRA: SRX2768351 Raw miRNA-Seq intermediate myofibers This paper SRA: SRX2768352 Raw miRNA-Seq slow myofibers This paper SRA: SRX2768353 Experimental Models: Cell Lines Mouse: C2C12 ATCC CRL-1772; RRID: CVCL_0188 Human: Primary Skeletal Muscle Myoblasts abm T4068 (Continued on next page) e1 Cell Reports 26, 3784–3797.e1–e8, March 26, 2019 .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental Models: Organisms/Strains Mouse: CD1 Charles River CD-1 IGS Mouse Mouse: C57BL/6J The Jackson Laboratory JAX: 000664 Oligonucleotides Primers for qRT-PCR: see Table S4 This paper N/A oligo-dT-Ion P1 Adaptor primer: CCTCTCTATGGGCAG TCGGTGATCCTCAGC[dT]20VN This paper N/A SMART primer: CACACACAATTAACCCTCACTAAAggg This paper N/A A Adaptor primer: CCATCTCATCCCTGCGTGTCTCC GACTCAG This paper N/A Primers luciferase assay: see Table S4 This paper N/A Recombinant DNA PCMVMIR MicroRNA Expression Vector Origene PCMVMIR PCMVMIR-27a Origene SC400942 PCMVMIR-142 Origene SC400778 Mito-RFP Evrogen FP147 pmirGLO Dual-Luciferase miRNA Target Expression Vector Promega E1330 Software and Algorithms Primer3Plus Untergasser et al., 2007 http://www.bioinformatics.nl/cgi-bin/ primer3plus/primer3plus.cgi Feature Extraction Software v. 10.7.3.1 Agilent Technologies G4463AA Expander Sharan et al., 2003 http://acgt.cs.tau.ac.il/expander/ Multiple Experiment Viewer Saeed et al., 2003 https://sourceforge.net/projects/mev-tm4/ SAM: Significance Analysis of Microarrays Tusher et al., 2001 http://statweb.stanford.edu/ tibs/SAM/ DAVID Bioinformatics Resources Huang et al., 2009 https://david.ncifcrf.gov/ PAM: Prediction Analysis for Microarrays Tibshirani et al., 2002 http://statweb.stanford.edu/ tibs/PAM/ miRDeep Friedländer et al., 2008 https://sourceforge.net/projects/mirdeepstar/ Cytoscape Shannon et al., 2003 https://cytoscape.org/ Prism Graphpad https://www.graphpad.com/scientific- software/prism/ ExpressionSuite Software Thermo Fischer Scientific https://www.thermofisher.com/us/en/home/ technical-resources/software-downloads/ expressionsuite-software.html ImageJ NIH https://imagej.nih.gov/ij/ MitoLoc Vowinckel et al., 2015 https://www.gurdon.cam.ac.uk/institute-life/ downloadspublic/imaging-plugins Other Rodent Diet With 60 kcal% Fat Research Diets D12492 ..

    Expressing:

    Article Title: Transcriptomic Analysis of Single Isolated Myofibers Identifies miR-27a-3p and miR-142-3p as Regulators of Metabolism in Skeletal Muscle.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Tom20 Antibody (FL-145) Santa Cruz sc-11415; RRID: AB_2207533 Goat anti-Rabbit IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 568 Life Technologies A-11011; RRID: AB_143157 Myosin Heavy Chain Type IIA Antibody DSHB SC-71; RRID: AB_2147165 Anti-Dystrophin antibody Abcam ab15277 Alexa Fluor 488 AffiniPure Goat Anti-Mouse IgG, Fcg subclass 1 specific Jackson Immunoresearch 115545205; RRID: AB_2338854 Alexa Fluor 647 AffiniPure Goat Anti-Rabbit IgG (H+L) Jackson Immunoresearch 111605003; RRID: AB_2338072 Anti-GAA antibody produced in rabbit Sigma-Aldrich SAB2100872; RRID: AB_10604782 Anti-FNDC5 antibody [EPR12209] Abcam ab174833 Anti-FNDC5 antibody - C-terminal Abcam ab181884 Anti-PGM2 antibody [EPR10393(B)] Abcam ab151746 Rabbit IgG, HRP-linked whole Ab Amersham NA934; RRID: AB_772206 Bacterial and Virus Strains DH10b competent cells ThermoFisher 18290015 Biological Samples Soleus Muscles CD1 mice N/A EDL Muscles CD1 mice N/A C2C12 ATCC CRL-1772; RRID: CVCL_0188 Human primary myoblasts ABM T4068 Chemicals, Peptides, and Recombinant Proteins BODIPY 493/503 Life Technologies D3922 Critical Commercial Assays Complete Whole Transcriptome Amplification Kit Sigma-Aldrich WTA2 SureTag DNA Labeling Kit Agilent Technologies 5190-3400 Low Input Quick Amp Labeling Kit, one-color Agilent Technologies 5190-2305 SurePrint G3 Mouse GE 8x60K Microarray Kit Agilent Technologies G4852A Megaplex PreAmp Primers, Rodent Pool Set v3.0 Thermo Fischer Scientific 4444747 Megaplex RT Primers, Rodent Pool Set v3.0 Thermo Fischer Scientific 4444746 Seahorse XF Palmitate-BSA FAO Substrate Seahorse Bioscience 102720-100 Deposited Data Agilent SurePrint G3 Mouse GE 8x60K Microarray Platform dataset Agilent Technologies https://www.ncbi.nlm.nih.gov/geo/query/ acc.cgi?acc=GPL10787 miRBase, V.19 Griffiths-Jones, 2004 http://www.mirbase.org/ TargetScan, V.6.2 Friedman et al., 2009 www.targetscan.org/ mirSVR, August 2010 release Betel et al., 2010 http://www.microrna.org/microrna/home.do Raw microarray data This paper GEO: GSE98328 Raw miRNA-Seq fast myofibers This paper SRA: SRX2768351 Raw miRNA-Seq intermediate myofibers This paper SRA: SRX2768352 Raw miRNA-Seq slow myofibers This paper SRA: SRX2768353 Experimental Models: Cell Lines Mouse: C2C12 ATCC CRL-1772; RRID: CVCL_0188 Human: Primary Skeletal Muscle Myoblasts abm T4068 (Continued on next page) e1 Cell Reports 26, 3784–3797.e1–e8, March 26, 2019 .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental Models: Organisms/Strains Mouse: CD1 Charles River CD-1 IGS Mouse Mouse: C57BL/6J The Jackson Laboratory JAX: 000664 Oligonucleotides Primers for qRT-PCR: see Table S4 This paper N/A oligo-dT-Ion P1 Adaptor primer: CCTCTCTATGGGCAG TCGGTGATCCTCAGC[dT]20VN This paper N/A SMART primer: CACACACAATTAACCCTCACTAAAggg This paper N/A A Adaptor primer: CCATCTCATCCCTGCGTGTCTCC GACTCAG This paper N/A Primers luciferase assay: see Table S4 This paper N/A Recombinant DNA PCMVMIR MicroRNA Expression Vector Origene PCMVMIR PCMVMIR-27a Origene SC400942 PCMVMIR-142 Origene SC400778 Mito-RFP Evrogen FP147 pmirGLO Dual-Luciferase miRNA Target Expression Vector Promega E1330 Software and Algorithms Primer3Plus Untergasser et al., 2007 http://www.bioinformatics.nl/cgi-bin/ primer3plus/primer3plus.cgi Feature Extraction Software v. 10.7.3.1 Agilent Technologies G4463AA Expander Sharan et al., 2003 http://acgt.cs.tau.ac.il/expander/ Multiple Experiment Viewer Saeed et al., 2003 https://sourceforge.net/projects/mev-tm4/ SAM: Significance Analysis of Microarrays Tusher et al., 2001 http://statweb.stanford.edu/ tibs/SAM/ DAVID Bioinformatics Resources Huang et al., 2009 https://david.ncifcrf.gov/ PAM: Prediction Analysis for Microarrays Tibshirani et al., 2002 http://statweb.stanford.edu/ tibs/PAM/ miRDeep Friedländer et al., 2008 https://sourceforge.net/projects/mirdeepstar/ Cytoscape Shannon et al., 2003 https://cytoscape.org/ Prism Graphpad https://www.graphpad.com/scientific- software/prism/ ExpressionSuite Software Thermo Fischer Scientific https://www.thermofisher.com/us/en/home/ technical-resources/software-downloads/ expressionsuite-software.html ImageJ NIH https://imagej.nih.gov/ij/ MitoLoc Vowinckel et al., 2015 https://www.gurdon.cam.ac.uk/institute-life/ downloadspublic/imaging-plugins Other Rodent Diet With 60 kcal% Fat Research Diets D12492 ..

    Software:

    Article Title: Transcriptomic Analysis of Single Isolated Myofibers Identifies miR-27a-3p and miR-142-3p as Regulators of Metabolism in Skeletal Muscle.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Tom20 Antibody (FL-145) Santa Cruz sc-11415; RRID: AB_2207533 Goat anti-Rabbit IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 568 Life Technologies A-11011; RRID: AB_143157 Myosin Heavy Chain Type IIA Antibody DSHB SC-71; RRID: AB_2147165 Anti-Dystrophin antibody Abcam ab15277 Alexa Fluor 488 AffiniPure Goat Anti-Mouse IgG, Fcg subclass 1 specific Jackson Immunoresearch 115545205; RRID: AB_2338854 Alexa Fluor 647 AffiniPure Goat Anti-Rabbit IgG (H+L) Jackson Immunoresearch 111605003; RRID: AB_2338072 Anti-GAA antibody produced in rabbit Sigma-Aldrich SAB2100872; RRID: AB_10604782 Anti-FNDC5 antibody [EPR12209] Abcam ab174833 Anti-FNDC5 antibody - C-terminal Abcam ab181884 Anti-PGM2 antibody [EPR10393(B)] Abcam ab151746 Rabbit IgG, HRP-linked whole Ab Amersham NA934; RRID: AB_772206 Bacterial and Virus Strains DH10b competent cells ThermoFisher 18290015 Biological Samples Soleus Muscles CD1 mice N/A EDL Muscles CD1 mice N/A C2C12 ATCC CRL-1772; RRID: CVCL_0188 Human primary myoblasts ABM T4068 Chemicals, Peptides, and Recombinant Proteins BODIPY 493/503 Life Technologies D3922 Critical Commercial Assays Complete Whole Transcriptome Amplification Kit Sigma-Aldrich WTA2 SureTag DNA Labeling Kit Agilent Technologies 5190-3400 Low Input Quick Amp Labeling Kit, one-color Agilent Technologies 5190-2305 SurePrint G3 Mouse GE 8x60K Microarray Kit Agilent Technologies G4852A Megaplex PreAmp Primers, Rodent Pool Set v3.0 Thermo Fischer Scientific 4444747 Megaplex RT Primers, Rodent Pool Set v3.0 Thermo Fischer Scientific 4444746 Seahorse XF Palmitate-BSA FAO Substrate Seahorse Bioscience 102720-100 Deposited Data Agilent SurePrint G3 Mouse GE 8x60K Microarray Platform dataset Agilent Technologies https://www.ncbi.nlm.nih.gov/geo/query/ acc.cgi?acc=GPL10787 miRBase, V.19 Griffiths-Jones, 2004 http://www.mirbase.org/ TargetScan, V.6.2 Friedman et al., 2009 www.targetscan.org/ mirSVR, August 2010 release Betel et al., 2010 http://www.microrna.org/microrna/home.do Raw microarray data This paper GEO: GSE98328 Raw miRNA-Seq fast myofibers This paper SRA: SRX2768351 Raw miRNA-Seq intermediate myofibers This paper SRA: SRX2768352 Raw miRNA-Seq slow myofibers This paper SRA: SRX2768353 Experimental Models: Cell Lines Mouse: C2C12 ATCC CRL-1772; RRID: CVCL_0188 Human: Primary Skeletal Muscle Myoblasts abm T4068 (Continued on next page) e1 Cell Reports 26, 3784–3797.e1–e8, March 26, 2019 .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental Models: Organisms/Strains Mouse: CD1 Charles River CD-1 IGS Mouse Mouse: C57BL/6J The Jackson Laboratory JAX: 000664 Oligonucleotides Primers for qRT-PCR: see Table S4 This paper N/A oligo-dT-Ion P1 Adaptor primer: CCTCTCTATGGGCAG TCGGTGATCCTCAGC[dT]20VN This paper N/A SMART primer: CACACACAATTAACCCTCACTAAAggg This paper N/A A Adaptor primer: CCATCTCATCCCTGCGTGTCTCC GACTCAG This paper N/A Primers luciferase assay: see Table S4 This paper N/A Recombinant DNA PCMVMIR MicroRNA Expression Vector Origene PCMVMIR PCMVMIR-27a Origene SC400942 PCMVMIR-142 Origene SC400778 Mito-RFP Evrogen FP147 pmirGLO Dual-Luciferase miRNA Target Expression Vector Promega E1330 Software and Algorithms Primer3Plus Untergasser et al., 2007 http://www.bioinformatics.nl/cgi-bin/ primer3plus/primer3plus.cgi Feature Extraction Software v. 10.7.3.1 Agilent Technologies G4463AA Expander Sharan et al., 2003 http://acgt.cs.tau.ac.il/expander/ Multiple Experiment Viewer Saeed et al., 2003 https://sourceforge.net/projects/mev-tm4/ SAM: Significance Analysis of Microarrays Tusher et al., 2001 http://statweb.stanford.edu/ tibs/SAM/ DAVID Bioinformatics Resources Huang et al., 2009 https://david.ncifcrf.gov/ PAM: Prediction Analysis for Microarrays Tibshirani et al., 2002 http://statweb.stanford.edu/ tibs/PAM/ miRDeep Friedländer et al., 2008 https://sourceforge.net/projects/mirdeepstar/ Cytoscape Shannon et al., 2003 https://cytoscape.org/ Prism Graphpad https://www.graphpad.com/scientific- software/prism/ ExpressionSuite Software Thermo Fischer Scientific https://www.thermofisher.com/us/en/home/ technical-resources/software-downloads/ expressionsuite-software.html ImageJ NIH https://imagej.nih.gov/ij/ MitoLoc Vowinckel et al., 2015 https://www.gurdon.cam.ac.uk/institute-life/ downloadspublic/imaging-plugins Other Rodent Diet With 60 kcal% Fat Research Diets D12492 ..

    Extraction:

    Article Title: Transcriptomic Analysis of Single Isolated Myofibers Identifies miR-27a-3p and miR-142-3p as Regulators of Metabolism in Skeletal Muscle.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Tom20 Antibody (FL-145) Santa Cruz sc-11415; RRID: AB_2207533 Goat anti-Rabbit IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 568 Life Technologies A-11011; RRID: AB_143157 Myosin Heavy Chain Type IIA Antibody DSHB SC-71; RRID: AB_2147165 Anti-Dystrophin antibody Abcam ab15277 Alexa Fluor 488 AffiniPure Goat Anti-Mouse IgG, Fcg subclass 1 specific Jackson Immunoresearch 115545205; RRID: AB_2338854 Alexa Fluor 647 AffiniPure Goat Anti-Rabbit IgG (H+L) Jackson Immunoresearch 111605003; RRID: AB_2338072 Anti-GAA antibody produced in rabbit Sigma-Aldrich SAB2100872; RRID: AB_10604782 Anti-FNDC5 antibody [EPR12209] Abcam ab174833 Anti-FNDC5 antibody - C-terminal Abcam ab181884 Anti-PGM2 antibody [EPR10393(B)] Abcam ab151746 Rabbit IgG, HRP-linked whole Ab Amersham NA934; RRID: AB_772206 Bacterial and Virus Strains DH10b competent cells ThermoFisher 18290015 Biological Samples Soleus Muscles CD1 mice N/A EDL Muscles CD1 mice N/A C2C12 ATCC CRL-1772; RRID: CVCL_0188 Human primary myoblasts ABM T4068 Chemicals, Peptides, and Recombinant Proteins BODIPY 493/503 Life Technologies D3922 Critical Commercial Assays Complete Whole Transcriptome Amplification Kit Sigma-Aldrich WTA2 SureTag DNA Labeling Kit Agilent Technologies 5190-3400 Low Input Quick Amp Labeling Kit, one-color Agilent Technologies 5190-2305 SurePrint G3 Mouse GE 8x60K Microarray Kit Agilent Technologies G4852A Megaplex PreAmp Primers, Rodent Pool Set v3.0 Thermo Fischer Scientific 4444747 Megaplex RT Primers, Rodent Pool Set v3.0 Thermo Fischer Scientific 4444746 Seahorse XF Palmitate-BSA FAO Substrate Seahorse Bioscience 102720-100 Deposited Data Agilent SurePrint G3 Mouse GE 8x60K Microarray Platform dataset Agilent Technologies https://www.ncbi.nlm.nih.gov/geo/query/ acc.cgi?acc=GPL10787 miRBase, V.19 Griffiths-Jones, 2004 http://www.mirbase.org/ TargetScan, V.6.2 Friedman et al., 2009 www.targetscan.org/ mirSVR, August 2010 release Betel et al., 2010 http://www.microrna.org/microrna/home.do Raw microarray data This paper GEO: GSE98328 Raw miRNA-Seq fast myofibers This paper SRA: SRX2768351 Raw miRNA-Seq intermediate myofibers This paper SRA: SRX2768352 Raw miRNA-Seq slow myofibers This paper SRA: SRX2768353 Experimental Models: Cell Lines Mouse: C2C12 ATCC CRL-1772; RRID: CVCL_0188 Human: Primary Skeletal Muscle Myoblasts abm T4068 (Continued on next page) e1 Cell Reports 26, 3784–3797.e1–e8, March 26, 2019 .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental Models: Organisms/Strains Mouse: CD1 Charles River CD-1 IGS Mouse Mouse: C57BL/6J The Jackson Laboratory JAX: 000664 Oligonucleotides Primers for qRT-PCR: see Table S4 This paper N/A oligo-dT-Ion P1 Adaptor primer: CCTCTCTATGGGCAG TCGGTGATCCTCAGC[dT]20VN This paper N/A SMART primer: CACACACAATTAACCCTCACTAAAggg This paper N/A A Adaptor primer: CCATCTCATCCCTGCGTGTCTCC GACTCAG This paper N/A Primers luciferase assay: see Table S4 This paper N/A Recombinant DNA PCMVMIR MicroRNA Expression Vector Origene PCMVMIR PCMVMIR-27a Origene SC400942 PCMVMIR-142 Origene SC400778 Mito-RFP Evrogen FP147 pmirGLO Dual-Luciferase miRNA Target Expression Vector Promega E1330 Software and Algorithms Primer3Plus Untergasser et al., 2007 http://www.bioinformatics.nl/cgi-bin/ primer3plus/primer3plus.cgi Feature Extraction Software v. 10.7.3.1 Agilent Technologies G4463AA Expander Sharan et al., 2003 http://acgt.cs.tau.ac.il/expander/ Multiple Experiment Viewer Saeed et al., 2003 https://sourceforge.net/projects/mev-tm4/ SAM: Significance Analysis of Microarrays Tusher et al., 2001 http://statweb.stanford.edu/ tibs/SAM/ DAVID Bioinformatics Resources Huang et al., 2009 https://david.ncifcrf.gov/ PAM: Prediction Analysis for Microarrays Tibshirani et al., 2002 http://statweb.stanford.edu/ tibs/PAM/ miRDeep Friedländer et al., 2008 https://sourceforge.net/projects/mirdeepstar/ Cytoscape Shannon et al., 2003 https://cytoscape.org/ Prism Graphpad https://www.graphpad.com/scientific- software/prism/ ExpressionSuite Software Thermo Fischer Scientific https://www.thermofisher.com/us/en/home/ technical-resources/software-downloads/ expressionsuite-software.html ImageJ NIH https://imagej.nih.gov/ij/ MitoLoc Vowinckel et al., 2015 https://www.gurdon.cam.ac.uk/institute-life/ downloadspublic/imaging-plugins Other Rodent Diet With 60 kcal% Fat Research Diets D12492 ..

    Fat:

    Article Title: Transcriptomic Analysis of Single Isolated Myofibers Identifies miR-27a-3p and miR-142-3p as Regulators of Metabolism in Skeletal Muscle.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Tom20 Antibody (FL-145) Santa Cruz sc-11415; RRID: AB_2207533 Goat anti-Rabbit IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 568 Life Technologies A-11011; RRID: AB_143157 Myosin Heavy Chain Type IIA Antibody DSHB SC-71; RRID: AB_2147165 Anti-Dystrophin antibody Abcam ab15277 Alexa Fluor 488 AffiniPure Goat Anti-Mouse IgG, Fcg subclass 1 specific Jackson Immunoresearch 115545205; RRID: AB_2338854 Alexa Fluor 647 AffiniPure Goat Anti-Rabbit IgG (H+L) Jackson Immunoresearch 111605003; RRID: AB_2338072 Anti-GAA antibody produced in rabbit Sigma-Aldrich SAB2100872; RRID: AB_10604782 Anti-FNDC5 antibody [EPR12209] Abcam ab174833 Anti-FNDC5 antibody - C-terminal Abcam ab181884 Anti-PGM2 antibody [EPR10393(B)] Abcam ab151746 Rabbit IgG, HRP-linked whole Ab Amersham NA934; RRID: AB_772206 Bacterial and Virus Strains DH10b competent cells ThermoFisher 18290015 Biological Samples Soleus Muscles CD1 mice N/A EDL Muscles CD1 mice N/A C2C12 ATCC CRL-1772; RRID: CVCL_0188 Human primary myoblasts ABM T4068 Chemicals, Peptides, and Recombinant Proteins BODIPY 493/503 Life Technologies D3922 Critical Commercial Assays Complete Whole Transcriptome Amplification Kit Sigma-Aldrich WTA2 SureTag DNA Labeling Kit Agilent Technologies 5190-3400 Low Input Quick Amp Labeling Kit, one-color Agilent Technologies 5190-2305 SurePrint G3 Mouse GE 8x60K Microarray Kit Agilent Technologies G4852A Megaplex PreAmp Primers, Rodent Pool Set v3.0 Thermo Fischer Scientific 4444747 Megaplex RT Primers, Rodent Pool Set v3.0 Thermo Fischer Scientific 4444746 Seahorse XF Palmitate-BSA FAO Substrate Seahorse Bioscience 102720-100 Deposited Data Agilent SurePrint G3 Mouse GE 8x60K Microarray Platform dataset Agilent Technologies https://www.ncbi.nlm.nih.gov/geo/query/ acc.cgi?acc=GPL10787 miRBase, V.19 Griffiths-Jones, 2004 http://www.mirbase.org/ TargetScan, V.6.2 Friedman et al., 2009 www.targetscan.org/ mirSVR, August 2010 release Betel et al., 2010 http://www.microrna.org/microrna/home.do Raw microarray data This paper GEO: GSE98328 Raw miRNA-Seq fast myofibers This paper SRA: SRX2768351 Raw miRNA-Seq intermediate myofibers This paper SRA: SRX2768352 Raw miRNA-Seq slow myofibers This paper SRA: SRX2768353 Experimental Models: Cell Lines Mouse: C2C12 ATCC CRL-1772; RRID: CVCL_0188 Human: Primary Skeletal Muscle Myoblasts abm T4068 (Continued on next page) e1 Cell Reports 26, 3784–3797.e1–e8, March 26, 2019 .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental Models: Organisms/Strains Mouse: CD1 Charles River CD-1 IGS Mouse Mouse: C57BL/6J The Jackson Laboratory JAX: 000664 Oligonucleotides Primers for qRT-PCR: see Table S4 This paper N/A oligo-dT-Ion P1 Adaptor primer: CCTCTCTATGGGCAG TCGGTGATCCTCAGC[dT]20VN This paper N/A SMART primer: CACACACAATTAACCCTCACTAAAggg This paper N/A A Adaptor primer: CCATCTCATCCCTGCGTGTCTCC GACTCAG This paper N/A Primers luciferase assay: see Table S4 This paper N/A Recombinant DNA PCMVMIR MicroRNA Expression Vector Origene PCMVMIR PCMVMIR-27a Origene SC400942 PCMVMIR-142 Origene SC400778 Mito-RFP Evrogen FP147 pmirGLO Dual-Luciferase miRNA Target Expression Vector Promega E1330 Software and Algorithms Primer3Plus Untergasser et al., 2007 http://www.bioinformatics.nl/cgi-bin/ primer3plus/primer3plus.cgi Feature Extraction Software v. 10.7.3.1 Agilent Technologies G4463AA Expander Sharan et al., 2003 http://acgt.cs.tau.ac.il/expander/ Multiple Experiment Viewer Saeed et al., 2003 https://sourceforge.net/projects/mev-tm4/ SAM: Significance Analysis of Microarrays Tusher et al., 2001 http://statweb.stanford.edu/ tibs/SAM/ DAVID Bioinformatics Resources Huang et al., 2009 https://david.ncifcrf.gov/ PAM: Prediction Analysis for Microarrays Tibshirani et al., 2002 http://statweb.stanford.edu/ tibs/PAM/ miRDeep Friedländer et al., 2008 https://sourceforge.net/projects/mirdeepstar/ Cytoscape Shannon et al., 2003 https://cytoscape.org/ Prism Graphpad https://www.graphpad.com/scientific- software/prism/ ExpressionSuite Software Thermo Fischer Scientific https://www.thermofisher.com/us/en/home/ technical-resources/software-downloads/ expressionsuite-software.html ImageJ NIH https://imagej.nih.gov/ij/ MitoLoc Vowinckel et al., 2015 https://www.gurdon.cam.ac.uk/institute-life/ downloadspublic/imaging-plugins Other Rodent Diet With 60 kcal% Fat Research Diets D12492 ..



    Similar Products

    paper n a smart primer  (OriGene)
    97
    OriGene paper n a smart primer
    Paper N A Smart Primer, supplied by OriGene, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/paper+n+a+smart+primer/Primer/pm30917329-240-39-70
    Average 97 stars, based on 1 article reviews
    paper n a smart primer - by Bioz Stars, 2026-10
    97/100 stars
    		  Buy from Supplier

    Image Search Results